تکه ای از متن پایان نامه :

 

3-7-3-  محلول­ها و بافر­های مورد نیاز جهت روش TUNEL، به ­مقصود ارزیابی شکست DNA اسپرم

1- بافر شستشو: PBS

گردد. کیت از 10 ویال که 5 عدد آن حاوی محلول نشانگر با درپوش بنفش رنگ و 5 عدد باقیمانده حاوی آنزیم TDT[1] با درپوش آبی می­باشد، تشکیل شده می باشد. محلول آنزیمی، وظیفه شناسایی شکستگی­های موجود در دو رشته DNA، از طریق انتهای آزاد 3´OH را بر عهده دارد. محلول نشانگر، یک نشانگر فلورسنت پلیمرهای نوکلئوتیدی می باشد که به وسیله میکروسکوپ فلورسنت تشخیص داده می­گردد.

3-8-  مطالعه اظهار ژن Kdm5d یا Smcy

آغاز با روش RT-PCR و سپس با روش Real-Time PCR بيان ژن مورد مطالعه، ارزيابي گردید. نام ژن مورد نظر و توالی پرايمر مورد بهره گیری در جدول3-3 آمده می باشد که با بهره گیری از نرم افزار Perl Primer طراحی گردید و برای اطمینان از پرایمر مربوطه توسط نرم افزار Gene Runner هم چک گردید.

 

شما می توانید مطالب مشابه این مطلب را با جستجو در همین سایت بخوانید                     

جدول (3-3): ژن مورد نظر و توالی پرايمر مورد بهره گیری(که توسط نگارنده طراحی شده می باشد)

نام ژن مورد نظر (5′         3′) توالی پرایمر
Gapdh FOR: 5´GACTTCAACAGCAACTCCCAC 3´

REV: 5´TCCACCACCCTGTTGCTGTA 3´

Kdm5d FOR: 5´ACT TGT CAC TCT GAT GAA TCC T 3´

REV: 5´TCC AAC AGG TAG CCA ATC G 3´

شما می توانید تکه های دیگری از این مطلب را در شماره بندی انتهای صفحه بخوانید              

 

 

 

 

 

 

 

3-8-1- استخراج RNA به روش ترایزول

استخراج RNA در سه مرحله، زیر هود شیمیایی و روی یخ انجام گردید. برای جلوگیری از آلودگی با DNA و احتمال از دست رفتن RNA، از ویال­های DNase-RNase free و سرسمپلرهای فیلتردار بهره گیری گردید.

مراحل کار به توضیح ذيل مي‌باشد:

[1]Terminal deoxynucleotidyl transferase

 

 

 

 دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با فرمت ورد ) :

پایان نامه بهره گیری ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به مقصود مطالعه اثر آن در چگونگی اظهار ژن Kdm5d(Smcy

دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با    فرمتPDF ) :

پایان نامه بهره گیری ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به مقصود مطالعه اثر آن در چگونگی اظهار ژن Kdm5d(Smcy