فایل پایان نامه : دانلود پایان نامه ارشد با عنوان : استفاده ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

دانلود پایان نامه

تکه ای از متن پایان نامه :

 

3-7-3-  محلول­ها و بافر­های مورد نیاز جهت روش TUNEL، به ­مقصود ارزیابی شکست DNA اسپرم

1- بافر شستشو: PBS

گردد. کیت از 10 ویال که 5 عدد آن حاوی محلول نشانگر با درپوش بنفش رنگ و 5 عدد باقیمانده حاوی آنزیم TDT[1] با درپوش آبی می­باشد، تشکیل شده می باشد. محلول آنزیمی، وظیفه شناسایی شکستگی­های موجود در دو رشته DNA، از طریق انتهای آزاد 3´OH را بر عهده دارد. محلول نشانگر، یک نشانگر فلورسنت پلیمرهای نوکلئوتیدی می باشد که به وسیله میکروسکوپ فلورسنت تشخیص داده می­گردد.

3-8-  مطالعه اظهار ژن Kdm5d یا Smcy

آغاز با روش RT-PCR و سپس با روش Real-Time PCR بيان ژن مورد مطالعه، ارزيابي گردید. نام ژن مورد نظر و توالی پرايمر مورد بهره گیری در جدول3-3 آمده می باشد که با بهره گیری از نرم افزار Perl Primer طراحی گردید و برای اطمینان از پرایمر مربوطه توسط نرم افزار Gene Runner هم چک گردید.

 

شما می توانید مطالب مشابه این مطلب را با جستجو در همین سایت بخوانید                     

جدول (3-3): ژن مورد نظر و توالی پرايمر مورد بهره گیری(که توسط نگارنده طراحی شده می باشد)

نام ژن مورد نظر (5′         3′) توالی پرایمر
Gapdh FOR: 5´GACTTCAACAGCAACTCCCAC 3´

REV: 5´TCCACCACCCTGTTGCTGTA 3´

Kdm5d FOR: 5´ACT TGT CAC TCT GAT GAA TCC T 3´

REV: 5´TCC AAC AGG TAG CCA ATC G 3´

شما می توانید تکه های دیگری از این مطلب را در شماره بندی انتهای صفحه بخوانید              

 

 

 

 

 

 

 

3-8-1- استخراج RNA به روش ترایزول

استخراج RNA در سه مرحله، زیر هود شیمیایی و روی یخ انجام گردید. برای جلوگیری از آلودگی با DNA و احتمال از دست رفتن RNA، از ویال­های DNase-RNase free و سرسمپلرهای فیلتردار بهره گیری گردید.

مراحل کار به توضیح ذيل مي‌باشد:

[1]Terminal deoxynucleotidyl transferase

 

 

 

 دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با فرمت ورد ) :

پایان نامه بهره گیری ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به مقصود مطالعه اثر آن در چگونگی اظهار ژن Kdm5d(Smcy

دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با    فرمتPDF ) :

پایان نامه بهره گیری ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به مقصود مطالعه اثر آن در چگونگی اظهار ژن Kdm5d(Smcy

این نوشته در پایان نامه های ارشد ارسال شده است. افزودن پیوند یکتا به علاقه‌مندی‌ها.